Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 396953
End position: 396997
Length: 45

DNA sequence
>NC_014222, from 396953 to 396997 (45 bp); Methanococcus voltae A3 ATTTTTATTATTTTTATTATTATTTTTATTATTCTTATTATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 395496-397025	Sequence	Mvol_0363 - hypothetical protein (Protein is coded in complementary strand; from 397025 to 395496)