Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 377228
End position: 377254
Length: 27

DNA sequence
>NC_014222, from 377228 to 377254 (27 bp); Methanococcus voltae A3 TCTTCGTAATCTTCATAATCTTCATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 377201-377857	Sequence	Mvol_0346 - putative signal transduction protein (Protein is coded in complementary strand; from 377857 to 377201)