Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 373365
End position: 373391
Length: 27

DNA sequence
>NC_014222, from 373365 to 373391 (27 bp); Methanococcus voltae A3 TATTTTCACTATTTTCACTATTTTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 372647-373732	Sequence	Mvol_0341 - sodium/calcium exchanger membrane region (Protein is coded in complementary strand; from 373732 to 372647)