Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 37186
End position: 37221
Length: 36

DNA sequence
>NC_014222, from 37186 to 37221 (36 bp); Methanococcus voltae A3 TCTTCTTCGTATTCTTCGTATTCTTCGTATTCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 35743-37596	Sequence	Mvol_0038 - fumarate reductase/succinate dehydrogenase flavoprotein domain-containing protein (Protein is coded in complementary strand; from 37596 to 35743)