Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 364577
End position: 364603
Length: 27

DNA sequence
>NC_014222, from 364577 to 364603 (27 bp); Methanococcus voltae A3 TTTCTTTATTTTCTTTATTTTCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 364525-364893	Sequence	Mvol_0335 - hypothetical protein (Protein is coded in complementary strand; from 364893 to 364525)