Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 348484
End position: 348519
Length: 36

DNA sequence
>NC_014222, from 348484 to 348519 (36 bp); Methanococcus voltae A3 TAAATACACTAAATACACTAAATACACTAAATACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 345716-348487	Sequence	Mvol_0317 - type I site-specific deoxyribonuclease, HsdR family