Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 34457
End position: 34483
Length: 27

DNA sequence
>NC_014222, from 34457 to 34483 (27 bp); Methanococcus voltae A3 TTATCTATTTTATCTATTTTATCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 34031-34483	Sequence	Mvol_0036 - hypothetical protein (Protein is coded in complementary strand; from 34483 to 34031)