Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 322421
End position: 322447
Length: 27

DNA sequence
>NC_014222, from 322421 to 322447 (27 bp); Methanococcus voltae A3 TTTTTCATTTTTTTCATTTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 321837-323285	Sequence	Mvol_0293 - hypothetical protein (Protein is coded in complementary strand; from 323285 to 321837)