Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 305277
End position: 305303
Length: 27

DNA sequence
>NC_014222, from 305277 to 305303 (27 bp); Methanococcus voltae A3 TTTTTATTATTTTCATTATTTTCATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 304947-306197	Sequence	Mvol_0279 - hypothetical protein (Protein is coded in complementary strand; from 306197 to 304947)