Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 289301
End position: 289333
Length: 33

DNA sequence
>NC_014222, from 289301 to 289333 (33 bp); Methanococcus voltae A3 TTTAATATAATATTAGTATAATATTAGTATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 289325-290410	Sequence	Mvol_0265 - IMP biosynthesis enzyme PurP domain-containing protein (Protein is coded in complementary strand; from 290410 to 289325)