Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 278879
End position: 278905
Length: 27

DNA sequence
>NC_014222, from 278879 to 278905 (27 bp); Methanococcus voltae A3 TTAGTTTCCTTAATTTCCTTAATTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 277325-279637	Sequence	Mvol_0259 - hypothetical protein (Protein is coded in complementary strand; from 279637 to 277325)