Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 258915
End position: 258941
Length: 27

DNA sequence
>NC_014222, from 258915 to 258941 (27 bp); Methanococcus voltae A3 TTATTATCCTTATTATCCTTATTATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 258108-259100	Sequence	Mvol_0242 - NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 259100 to 258108)