Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 251549
End position: 251588
Length: 40

DNA sequence
>NC_014222, from 251549 to 251588 (40 bp); Methanococcus voltae A3 ATTATAATTTATTTTACTTTATTTTAATTCATTATACGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 250801-251556	Sequence	Mvol_0236 - histidine biosynthesis protein
ORF. 251546-252868	Sequence	Mvol_0237 - group 1 glycosyl transferase