Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 250357
End position: 250383
Length: 27

DNA sequence
>NC_014222, from 250357 to 250383 (27 bp); Methanococcus voltae A3 TAATAATACTAATAATACTAATAATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 249981-250676	Sequence	Mvol_0235 - imidazole glycerol phosphate synthase, glutamine amidotransferase subunit