Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 243109
End position: 243135
Length: 27

DNA sequence
>NC_014222, from 243109 to 243135 (27 bp); Methanococcus voltae A3 GTTCTTATTATTCTTATTATTCTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 242189-244825	Sequence	Mvol_0230 - DEAD/DEAH box helicase domain-containing protein (Protein is coded in complementary strand; from 244825 to 242189)