Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1922344
End position: 1922367
Length: 24

DNA sequence
>NC_014222, from 1922344 to 1922367 (24 bp); Methanococcus voltae A3 ATTCTTTTATTCTTTAATTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1922351-1923052	Sequence	Mvol_1712 - precorrin-2 C20-methyltransferase (Protein is coded in complementary strand; from 1923052 to 1922351)