Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1875799
End position: 1875825
Length: 27

DNA sequence
>NC_014222, from 1875799 to 1875825 (27 bp); Methanococcus voltae A3 AATTACATAAATTACATAAATTACATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1875820-1878459	Sequence	Mvol_1670 - DNA polymerase Pol2 (Protein is coded in complementary strand; from 1878459 to 1875820)