Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1845357
End position: 1845386
Length: 30

DNA sequence
>NC_014222, from 1845357 to 1845386 (30 bp); Methanococcus voltae A3 ATTTTATTTATTTTTAGTTATTTTTAGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1845381-1846871	Sequence	Mvol_1647 - MiaB-like tRNA modifying protein (Protein is coded in complementary strand; from 1846871 to 1845381)