Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1834961
End position: 1835008
Length: 48

DNA sequence
>NC_014222, from 1834961 to 1835008 (48 bp); Methanococcus voltae A3 TTTTTAAATTATTTATATTTTAGATTATTTATATTTTAAATTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1834997-1836541	Sequence	Mvol_1638 - sodium:neurotransmitter symporter (Protein is coded in complementary strand; from 1836541 to 1834997)