Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1795710
End position: 1795745
Length: 36

DNA sequence
>NC_014222, from 1795710 to 1795745 (36 bp); Methanococcus voltae A3 TAAAGATAATACTAATGATGATACTAACGATAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1795055-1796314	Sequence	Mvol_1602 - 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein