Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 17653
End position: 17679
Length: 27

DNA sequence
>NC_014222, from 17653 to 17679 (27 bp); Methanococcus voltae A3 ATTATGATTATTATGATTATTATGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 17363-17923	Sequence	Mvol_0026 - hypothetical protein (Protein is coded in complementary strand; from 17923 to 17363)