Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1752227
End position: 1752253
Length: 27

DNA sequence
>NC_014222, from 1752227 to 1752253 (27 bp); Methanococcus voltae A3 TTTTAATCTTTTTAATCATTTTAGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1752248-1752724	Sequence	Mvol_1556 - PadR-like family transcriptional regulator (Protein is coded in complementary strand; from 1752724 to 1752248)