Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1731175
End position: 1731198
Length: 24

DNA sequence
>NC_014222, from 1731175 to 1731198 (24 bp); Methanococcus voltae A3 CATTAGCATTAGCATTAGCATTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1730481-1731671	Sequence	Mvol_1535 - hypothetical protein (Protein is coded in complementary strand; from 1731671 to 1730481)