Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 169767
End position: 169790
Length: 24

DNA sequence
>NC_014222, from 169767 to 169790 (24 bp); Methanococcus voltae A3 GAAATAAAGAAATAATGAATTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 169787-170596	Sequence	Mvol_0166 - stationary-phase survival protein SurE (Protein is coded in complementary strand; from 170596 to 169787)