Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1620681
End position: 1620707
Length: 27

DNA sequence
>NC_014222, from 1620681 to 1620707 (27 bp); Methanococcus voltae A3 TTTTCATTATTTTCCTTATTTTCATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1619439-1620728	Sequence	Mvol_1440 - 3-hydroxy-3-methylglutaryl Coenzyme A reductase (Protein is coded in complementary strand; from 1620728 to 1619439)