Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1571985
End position: 1572011
Length: 27

DNA sequence
>NC_014222, from 1571985 to 1572011 (27 bp); Methanococcus voltae A3 ATAATACTAATAATACTAATAATACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1571379-1572515	Sequence	Mvol_1404 - pyruvate flavodoxin/ferredoxin oxidoreductase domain-containing protein