Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 153138
End position: 153164
Length: 27

DNA sequence
>NC_014222, from 153138 to 153164 (27 bp); Methanococcus voltae A3 GTATTAATATTATTAATAGTATTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 152565-153299	Sequence	Mvol_0146 - hypothetical protein (Protein is coded in complementary strand; from 153299 to 152565)