Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1527390
End position: 1527437
Length: 48

DNA sequence
>NC_014222, from 1527390 to 1527437 (48 bp); Methanococcus voltae A3 ATATTAATTTTATTATTATTATTATTATTATTATTAGTATTATTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1527436-1528569	Sequence	Mvol_1365 - NMD3 family protein (Protein is coded in complementary strand; from 1528569 to 1527436)