Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1478528
End position: 1478551
Length: 24

DNA sequence
>NC_014222, from 1478528 to 1478551 (24 bp); Methanococcus voltae A3 ATGAAAATGAAAAAGAAAATTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1477778-1478551	Sequence	Mvol_1317 - hypothetical protein
ORF... 1478529-1478810	Sequence	Mvol_1318 - 50S ribosomal protein L44E