Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1394374
End position: 1394403
Length: 30

DNA sequence
>NC_014222, from 1394374 to 1394403 (30 bp); Methanococcus voltae A3 TAAAAATATTTCAAATTATTTCAATATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1394403-1394912	Sequence	Mvol_1243 - 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein (Protein is coded in complementary strand; from 1394912 to 1394403)