Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1371225
End position: 1371251
Length: 27

DNA sequence
>NC_014222, from 1371225 to 1371251 (27 bp); Methanococcus voltae A3 ACCTTTTTTACCTTTTTTACCTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1370878-1371339	Sequence	Mvol_1219 - hypothetical protein (Protein is coded in complementary strand; from 1371339 to 1370878)