Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1354682
End position: 1354708
Length: 27

DNA sequence
>NC_014222, from 1354682 to 1354708 (27 bp); Methanococcus voltae A3 TGGTTTTTATCGTTTTTATCGTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1353619-1354758	Sequence	Mvol_1200 - hypothetical protein (Protein is coded in complementary strand; from 1354758 to 1353619)