Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1331700
End position: 1331723
Length: 24

DNA sequence
>NC_014222, from 1331700 to 1331723 (24 bp); Methanococcus voltae A3 CTCTTCCACTTCTTCTTCATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1331245-1331949	Sequence	Mvol_1181 - chromosome segregation and condensation protein ScpA (Protein is coded in complementary strand; from 1331949 to 1331245)