Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1243918
End position: 1243952
Length: 35

DNA sequence
>NC_014222, from 1243918 to 1243952 (35 bp); Methanococcus voltae A3 TTTTTAATCTTTAAGTTTTAATTTTTAATTTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1243943-1244809	Sequence	Mvol_1098 - type 11 methyltransferase (Protein is coded in complementary strand; from 1244809 to 1243943)