Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1236013
End position: 1236039
Length: 27

DNA sequence
>NC_014222, from 1236013 to 1236039 (27 bp); Methanococcus voltae A3 TTATTATCTTTATTATCTTTATTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1236004-1237140	Sequence	Mvol_1092 - hypothetical protein (Protein is coded in complementary strand; from 1237140 to 1236004)