Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1204239
End position: 1204265
Length: 27

DNA sequence
>NC_014222, from 1204239 to 1204265 (27 bp); Methanococcus voltae A3 CTTCAACTACTTCAGCTACTTCAACTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1204223-1204879	Sequence	Mvol_1058 - 30S ribosomal protein S3 (Protein is coded in complementary strand; from 1204879 to 1204223)