Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 119225
End position: 119254
Length: 30

DNA sequence
>NC_014222, from 119225 to 119254 (30 bp); Methanococcus voltae A3 AAAAAATTAAAAAATACTAATAAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 118015-119235	Sequence	Mvol_0113 - alpha-amylase
ORF. 119220-119348	Sequence	Mvol_0114 - hypothetical protein