Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1141821
End position: 1141856
Length: 36

DNA sequence
>NC_014222, from 1141821 to 1141856 (36 bp); Methanococcus voltae A3 AATATTATTACTATTATTACTATTATTACTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1141411-1142019	Sequence	Mvol_1001 - GCN5-like N-acetyltransferase (Protein is coded in complementary strand; from 1142019 to 1141411)