Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1109840
End position: 1109866
Length: 27

DNA sequence
>NC_014222, from 1109840 to 1109866 (27 bp); Methanococcus voltae A3 AATAAGGATACTAAGGATACTAAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1108623-1110764	Sequence	Mvol_0972 - Superfamily I DNA and RNA helicase-like protein