Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1105498
End position: 1105553
Length: 56

DNA sequence
>NC_014222, from 1105498 to 1105553 (56 bp); Methanococcus voltae A3 TAAATCTGCATACTAAAATCTGTATACTAAAATCTGTATACTAAAATCTGTATACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1105553-1106890	Sequence	Mvol_0969 - amidohydrolase (Protein is coded in complementary strand; from 1106890 to 1105553)