Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1104121
End position: 1104164
Length: 44

DNA sequence
>NC_014222, from 1104121 to 1104164 (44 bp); Methanococcus voltae A3 AAATGTATTAAAAATATAGTAAAAATATAGTAAAAATATATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1104163-1105431	Sequence	Mvol_0968 - beta-lactamase domain-containing protein (Protein is coded in complementary strand; from 1105431 to 1104163)