Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1096038
End position: 1096070
Length: 33

DNA sequence
>NC_014222, from 1096038 to 1096070 (33 bp); Methanococcus voltae A3 ATTTTTTTGTAATTATTTTATAATTATTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1096067-1099666	Sequence	Mvol_0963 - chromosome segregation protein SMC (Protein is coded in complementary strand; from 1099666 to 1096067)