Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1091481
End position: 1091516
Length: 36

DNA sequence
>NC_014222, from 1091481 to 1091516 (36 bp); Methanococcus voltae A3 TTGGTATATTCTTTGGTATATTCTTTGGTATATTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1090341-1091630	Sequence	Mvol_0958 - hypothetical protein (Protein is coded in complementary strand; from 1091630 to 1090341)