Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1083714
End position: 1083767
Length: 54

DNA sequence
>NC_014222, from 1083714 to 1083767 (54 bp); Methanococcus voltae A3 GGTATTATTATTATTATTACTATTATTAGTATTATTAGTATTATTAGTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1083764-1084372	Sequence	Mvol_0952 - hypothetical protein (Protein is coded in complementary strand; from 1084372 to 1083764)