Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1062773
End position: 1062808
Length: 36

DNA sequence
>NC_014222, from 1062773 to 1062808 (36 bp); Methanococcus voltae A3 TTATCGTTTATATTATCTTTTATATTATCATTCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1062092-1063258	Sequence	Mvol_0935 - chorismate synthase (Protein is coded in complementary strand; from 1063258 to 1062092)