Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1059639
End position: 1059662
Length: 24

DNA sequence
>NC_014222, from 1059639 to 1059662 (24 bp); Methanococcus voltae A3 TACTATTATTATTATTATTACTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1058600-1060093	Sequence	Mvol_0931 - phosphoesterase DHHA1 (Protein is coded in complementary strand; from 1060093 to 1058600)