Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1054976
End position: 1055002
Length: 27

DNA sequence
>NC_014222, from 1054976 to 1055002 (27 bp); Methanococcus voltae A3 CTTTTATTGCGTTTATTGCGTTTATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1052902-1055625	Sequence	Mvol_0928 - valyl-tRNA synthetase (Protein is coded in complementary strand; from 1055625 to 1052902)