Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1047755
End position: 1047781
Length: 27

DNA sequence
>NC_014222, from 1047755 to 1047781 (27 bp); Methanococcus voltae A3 ATGTTAAGTATGTTAAGTATGTTAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1047242-1047757	Sequence	Mvol_0922 - hypothetical protein (Protein is coded in complementary strand; from 1047757 to 1047242)