Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1032069
End position: 1032095
Length: 27

DNA sequence
>NC_014222, from 1032069 to 1032095 (27 bp); Methanococcus voltae A3 TTTTAATTTGTTTAATTTTTTTAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1030753-1032114	Sequence	Mvol_0908 - polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 1032114 to 1030753)
ORF... 1032095-1033744	Sequence	Mvol_0909 - hypothetical protein (Protein is coded in complementary strand; from 1033744 to 1032095)