Sequence retrieval

Genome: Methanococcus voltae A3
Start position: 1030722
End position: 1030753
Length: 32

DNA sequence
>NC_014222, from 1030722 to 1030753 (32 bp); Methanococcus voltae A3 ATTATTCTATTATTCTATTATTCTATTATTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1030753-1032114	Sequence	Mvol_0908 - polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 1032114 to 1030753)